View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15449_low_63 (Length: 240)

Name: NF15449_low_63
Description: NF15449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15449_low_63
NF15449_low_63
[»] chr8 (1 HSPs)
chr8 (18-240)||(35112320-35112542)
[»] chr3 (2 HSPs)
chr3 (167-220)||(38117844-38117897)
chr3 (167-218)||(38127659-38127710)


Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 35112320 - 35112542
Alignment:
Q  18 cgtgttattggtacgaagtatccaccggctttgccgatgagtactactgctatgtttacaaactggacttcttttttaaactctgatcttgatgtatttg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35112320 cgtgttattggtacgaagtatccaccggctttgccgatgagtactactgctatgtttacaaactggacttcttttttaaactctgatcttgatgtatttg 35112419  T
Q  118 cttttatatcattcttcctgtcttgttcaacatacaggatgtcagaatctccatttcaaattggaccaatccttcttgtaaatgaacccttcacggttag 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35112420 cttttatatcattcttcctgtcttgttcaacatacaggatgtcagaatctccatttcaaattggaccaatccttcttgtaaatgaacccttcacggttag 35112519  T
Q  218 attttggaatttgaagttatatc 240  Q
    |||||||||||||||||| ||||    
T  35112520 attttggaatttgaagttgtatc 35112542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 167 - 220
Target Start/End: Complemental strand, 38117897 - 38117844
Alignment:
Q  167 tccatttcaaattggaccaatccttcttgtaaatgaacccttcacggttagatt 220  Q
    ||||||||||||||| ||||||||||| |||||||| |||||||||||||||||    
T  38117897 tccatttcaaattgggccaatccttctcgtaaatgatcccttcacggttagatt 38117844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 167 - 218
Target Start/End: Complemental strand, 38127710 - 38127659
Alignment:
Q  167 tccatttcaaattggaccaatccttcttgtaaatgaacccttcacggttaga 218  Q
    ||||||||||||||| ||||||||||| |||||||| |||||||||||||||    
T  38127710 tccatttcaaattgggccaatccttctcgtaaatgatcccttcacggttaga 38127659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University