View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15448_low_19 (Length: 253)

Name: NF15448_low_19
Description: NF15448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15448_low_19
NF15448_low_19
[»] chr3 (3 HSPs)
chr3 (9-239)||(29295129-29295359)
chr3 (174-213)||(29321411-29321450)
chr3 (174-213)||(29332602-29332641)


Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 9 - 239
Target Start/End: Complemental strand, 29295359 - 29295129
Alignment:
Q  9 gagatgaaagatgcgagcgaggagttaaggtctgcagctgttactgttattaaggagcttgatgaagcgaattcggatgggatggagagtgtggtaaaga 108  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29295359 gagatggaagatgcgagcgaggagttaaggtctgcagctgttactgttattaaggagcttgatgaagcgaattcggatgggatggagagtgtggtaaaga 29295260  T
Q  109 aattttctccggaggaagtgaagagagtattttctgttattatagctatgatgtcacatgttgtggatgatcctgtttggtatgatgttgatgataagaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29295259 aattttctccggaggaagtgaagagagtattttctgttattatagatatgatgtcacatgttgtggatgatcctgtttggtatgatgttgatgataagaa 29295160  T
Q  209 ttgtaaagatgttcggatgatagaggattat 239  Q
    ||||||||||||| || ||||||||||||||    
T  29295159 ttgtaaagatgttgggttgatagaggattat 29295129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 29321450 - 29321411
Alignment:
Q  174 gatgatcctgtttggtatgatgttgatgataagaattgta 213  Q
    ||||||||| ||||||||||||||||||||||||||||||    
T  29321450 gatgatcctctttggtatgatgttgatgataagaattgta 29321411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 29332641 - 29332602
Alignment:
Q  174 gatgatcctgtttggtatgatgttgatgataagaattgta 213  Q
    ||||||||| ||||||||||||| ||||||||||||||||    
T  29332641 gatgatcctctttggtatgatgtggatgataagaattgta 29332602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University