View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15448_high_11 (Length: 268)

Name: NF15448_high_11
Description: NF15448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15448_high_11
NF15448_high_11
[»] chr7 (1 HSPs)
chr7 (1-100)||(4953391-4953490)
[»] chr8 (1 HSPs)
chr8 (195-243)||(3265977-3266025)


Alignment Details
Target: chr7 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 4953490 - 4953391
Alignment:
Q  1 tggacttcattgcaaggacctttgtttactgattcaatgccgaaaccaaagtccatattaagtgataacattataggtatgtacccttttctctatcatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  4953490 tggacttcattgcaaggacctttgtttactgattcaatgccgaaaccaaagtccatattaagtgataacattataggtatgtacccttttctctaccatt 4953391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 195 - 243
Target Start/End: Original strand, 3265977 - 3266025
Alignment:
Q  195 tgattggtttcaagaatgatgtggcatgtttgtgttccttagatttcaa 243  Q
    |||||| ||||||||||||||||  ||||| |||| |||||||||||||    
T  3265977 tgattgatttcaagaatgatgtgaaatgttagtgtcccttagatttcaa 3266025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University