View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15442_low_22 (Length: 239)

Name: NF15442_low_22
Description: NF15442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15442_low_22
NF15442_low_22
[»] chr4 (1 HSPs)
chr4 (4-132)||(2024013-2024141)
[»] chr6 (1 HSPs)
chr6 (161-202)||(14194749-14194790)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 4 - 132
Target Start/End: Original strand, 2024013 - 2024141
Alignment:
Q  4 ttgaaactttgcagaagcatccactaaagatcaaaacgacacaggagcaacatattcatgctgaaactttcaagaaaaattgcagcacaaacctgccaaa 103  Q
    ||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2024013 ttgaaactttgcagaagcaccaactaaagatcaaaacaacacaggagcaacatattcatgctgaaactttcaagaaaaattgcagcacaaacctgccaaa 2024112  T
Q  104 ttatgcacagcagcgaacaaaaaacaaca 132  Q
    |||||||||||||||||||||||||||||    
T  2024113 ttatgcacagcagcgaacaaaaaacaaca 2024141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 161 - 202
Target Start/End: Complemental strand, 14194790 - 14194749
Alignment:
Q  161 attattaattgaggtgacactaatgtccattttgcatccttg 202  Q
    |||||||||| |||||||||||||||||||||||||||||||    
T  14194790 attattaattaaggtgacactaatgtccattttgcatccttg 14194749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University