View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15431_high_44 (Length: 221)

Name: NF15431_high_44
Description: NF15431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15431_high_44
NF15431_high_44
[»] chr1 (1 HSPs)
chr1 (21-207)||(4576119-4576305)


Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 21 - 207
Target Start/End: Original strand, 4576119 - 4576305
Alignment:
Q  21 ctcgaaccttcgccgcactcgaaaatcgttattggttttgattgtgaagctgttgacttgtgtcgcgatggagctctttgcataatccaggttagtgaat 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4576119 ctcgaaccttcgccgcactcgaaaatcgttattggttttgattgtgaagctgttgacttgtgtcgcgatggagctctttgcataatccaggttagtgaat 4576218  T
Q  121 ttaacnnnnnnnnnnnngtgctttacgtattctaattcatatatgaagtgtttgaaactgtgttctcattattctgaaatttctgtg 207  Q
    |||||            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4576219 ttaactttttcttttttgtgctttacgtattctaattcatatatgaagtgtttgaaactgtgttctcattattctgaaatttctgtg 4576305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University