View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15430_low_18 (Length: 227)

Name: NF15430_low_18
Description: NF15430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15430_low_18
NF15430_low_18
[»] chr1 (1 HSPs)
chr1 (79-212)||(8354184-8354317)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 79 - 212
Target Start/End: Complemental strand, 8354317 - 8354184
Alignment:
Q  79 atactattggcaattaattaataaatcaaatacacatgggttacctgcaattgctctggattagtgctgattatgaaatcatcagctcccaaacgttcct 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  8354317 atactattggcaattaattaataaatcaaatacacatgggttacctgcaattggtctggattagtgctgattatgaaatcatcagctcccaaacgttcct 8354218  T
Q  179 tagcctcagcttgtttggaaggagaagtacttat 212  Q
    ||||||||||||||||||||||||||||||||||    
T  8354217 tagcctcagcttgtttggaaggagaagtacttat 8354184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University