View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15429_low_12 (Length: 243)

Name: NF15429_low_12
Description: NF15429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15429_low_12
NF15429_low_12
[»] chr6 (2 HSPs)
chr6 (31-231)||(33930799-33930998)
chr6 (1-36)||(33931010-33931045)


Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 31 - 231
Target Start/End: Complemental strand, 33930998 - 33930799
Alignment:
Q  31 atttttgattgatttacggtcgattcacatcaattaaatccctctcgttttcgggaaaaatgagttttgataatttgaagtttagttaaaatgtaagtaa 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||||||||    
T  33930998 atttttgattgatttacggtcgattcacatcaattaaatccctctagttttcgggaaaaatgaattttgataatttgaagtttagtcaaaatgtaagtaa 33930899  T
Q  131 agtcaaggcaaagattgtttcagtcggaatttgaatttggattgttctaaacgattcgttttttattaaagtttattaaacacttgaattcaaatcacta 230  Q
    |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  33930898 agtcaaggtaaagattgtttcagtcggaatttgaacttggattgttctaaacgattcgt-ttttattaaagtttattaaacacttgaattcaaatcacta 33930800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 33931045 - 33931010
Alignment:
Q  1 cttttatgaaagatataattaaagtcaaatattttt 36  Q
    ||||||||||||||||||||||||| ||||||||||    
T  33931045 cttttatgaaagatataattaaagttaaatattttt 33931010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University