View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15429_high_8 (Length: 259)

Name: NF15429_high_8
Description: NF15429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15429_high_8
NF15429_high_8
[»] chr7 (1 HSPs)
chr7 (15-241)||(26936438-26936664)


Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 15 - 241
Target Start/End: Original strand, 26936438 - 26936664
Alignment:
Q  15 caaaggtgttcctgaaattgttaatattagccgagaagcatgttcgaatttatgcttacaggattgtaaatgtgctgcagcattgtattttcggacttca 114  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||    
T  26936438 caaaggtgttcctgaaattgttaatattagccgagaagcgtgttcgaatttatgcttacaggattgtaaatgtgctgcggcattgtattttcggaattca 26936537  T
Q  115 cacgtggaaacaacggaatgttatctttatagattagtccttggtctcaaacaggtagataaaggaccaggatttagttatatggtcaaggttccaaagg 214  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26936538 cacgtggaaacaacggaatgctatctttatagattagtccttggtctcaaacaggtagataaaggaccaggatttagttatatggtcaaggttccaaagg 26936637  T
Q  215 gaattggtagaaaacatgagaggcata 241  Q
    |||||||||||||||||||||||||||    
T  26936638 gaattggtagaaaacatgagaggcata 26936664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University