View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15428_low_25 (Length: 260)

Name: NF15428_low_25
Description: NF15428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15428_low_25
NF15428_low_25
[»] chr7 (1 HSPs)
chr7 (15-240)||(26331229-26331454)


Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 15 - 240
Target Start/End: Original strand, 26331229 - 26331454
Alignment:
Q  15 gagatgaatatccgaaatttccatgaccctgcaatatgtcctgtggaaatgactcctgatttccgttggcaggaagtccagtattattataaagtgaatt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  26331229 gagatgaatatccgaaatttccatgaccctgcaatatgtcctgtggaaatgactcctgatttccgttggcaggaagtccggtattattataaagtgaatt 26331328  T
Q  115 tgtgaaacttgatgaattggaataacagttaaccgctgagggcctaataggggctggtatgttgctgttggtcagagaatttctgttcagattgtaacct 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26331329 tgtgaaacttgatgaattggaataacagttaaccgctgagggcctaataggggctggtatgttgctgttggtcagagaatttctgttcagattgtaacct 26331428  T
Q  215 gcagaaccgcgtgcagctggtacatc 240  Q
    ||||||||||||||||||||||||||    
T  26331429 gcagaaccgcgtgcagctggtacatc 26331454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University