View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15423_low_61 (Length: 256)

Name: NF15423_low_61
Description: NF15423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15423_low_61
NF15423_low_61
[»] chr8 (2 HSPs)
chr8 (79-246)||(36689166-36689333)
chr8 (20-53)||(36689109-36689142)


Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 79 - 246
Target Start/End: Original strand, 36689166 - 36689333
Alignment:
Q  79 aacaaaaggaagttttggcattgatgtacgctttcgttataattttggccaatttgttcatgcttactcatgatgatttcaatttgaggcttcagcggct 178  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  36689166 aacaaaaggaagttttggcattgatgtacgctttcgtgataattttggccaatttgttcatgcttactcatgatgatttcaatttgaggcttcaacggct 36689265  T
Q  179 gaaagcgaagctaccacccttcatgttgcaatgcgcaaattacgattgatagtgaatgtcagcctttg 246  Q
    |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  36689266 gaaaccgaagctaccacccttcatgttgcaatgcgcaaactacgattgatagtgaatgtcagcctttg 36689333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 53
Target Start/End: Original strand, 36689109 - 36689142
Alignment:
Q  20 ttatgaatttgaggaagaagatgacattgaagat 53  Q
    ||||||||||||||||||||||||||||||||||    
T  36689109 ttatgaatttgaggaagaagatgacattgaagat 36689142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University