View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15421_high_3 (Length: 268)

Name: NF15421_high_3
Description: NF15421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15421_high_3
NF15421_high_3
[»] chr8 (2 HSPs)
chr8 (120-247)||(31139017-31139144)
chr8 (1-55)||(31138898-31138952)


Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 120 - 247
Target Start/End: Original strand, 31139017 - 31139144
Alignment:
Q  120 ctctacacgggtgtttgtttatacctaatgcttgtaggtttgaatattgaagaagggatgtccaactctcttgtgtatttacttttttggccaatatgat 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31139017 ctctacacgggtgtttgtttatacctaatgcttgtaggtttgaatattgaagaagggatgtccaactctcttgtgtatttacttttttggccaatatgat 31139116  T
Q  220 gatccatgatccccctcaaaaccctaga 247  Q
    ||||||||||||||||||||||||||||    
T  31139117 gatccatgatccccctcaaaaccctaga 31139144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 31138898 - 31138952
Alignment:
Q  1 gtgagcttaacgtagttgtgtgtcaagtgtgggtaatgcaaaagtctcaccttat 55  Q
    ||||||||||| || ||||||||||| ||||| ||||||||||||||||||||||    
T  31138898 gtgagcttaacttaattgtgtgtcaaatgtggataatgcaaaagtctcaccttat 31138952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University