View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15420_high_15 (Length: 228)

Name: NF15420_high_15
Description: NF15420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15420_high_15
NF15420_high_15
[»] chr4 (1 HSPs)
chr4 (107-200)||(33918983-33919076)


Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 107 - 200
Target Start/End: Complemental strand, 33919076 - 33918983
Alignment:
Q  107 cttgatatgaaatcgttaaatagtgtattagaagcactcctctttaacaagaacctacaaaaattagaaaactcttcttaaataaacgtagtag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33919076 cttgatatgaaatcgttaaatagtgtattagaagcactcctctttaacaagaacctacaaaaattagaaaactcttcttaaataaacgtagtag 33918983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University