View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1541_low_22 (Length: 275)

Name: NF1541_low_22
Description: NF1541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1541_low_22
NF1541_low_22
[»] chr1 (1 HSPs)
chr1 (10-260)||(48027385-48027635)


Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 10 - 260
Target Start/End: Original strand, 48027385 - 48027635
Alignment:
Q  10 caatgagttactacaaccaacaacaaccgcccgtcggcgttccaccccagcaaggtccatcctctattcttttcttaaccgcatgcatatacacttcaat 109  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  48027385 caatgagttactacaaccaacagcaaccgcccgtcggcgttccaccccagcaaggtccatcctctattcttttcttaaccgcatgcatatacactttaat 48027484  T
Q  110 tcaactcttgcatgttaatttatcatcttgattcttgatctttgctttaaattaattcaatttagtgatttcatggaattaacaggttacccggcgccgg 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48027485 tcaactcttgcatgttaatttatcatcttgattcttgatctttgctttaaattaattcaatttagtgatttcatggaattaacaggttacccggcgccgg 48027584  T
Q  210 agacttatggaaaagatgcttaccctccaccgggatatcctccacaaggtt 260  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48027585 agacttatggaaaagatgcttaccctccaccgggatatcctccacaaggtt 48027635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University