View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15415_high_30 (Length: 253)

Name: NF15415_high_30
Description: NF15415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15415_high_30
NF15415_high_30
[»] chr3 (1 HSPs)
chr3 (1-235)||(46387994-46388228)


Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 46387994 - 46388228
Alignment:
Q  1 aaaagtaacattttttcaacatccatagcagaaaaattggatgatacatgctagtttattgtaggcaacaaannnnnnnnacaactaaaatttattggaa 100  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||        ||||||||||||||||||||    
T  46387994 aaaagtaacattttttcaacattcatagcagaaaaattggatgatacatgttagtttattgtaggcaacaaattttttttacaactaaaatttattggaa 46388093  T
Q  101 gaacattaatgcaaagaagatgattgaaatggtttagagtgtagggaacgagactctgcaactgatttccattcaagtacatgccttaatgttttgtaca 200  Q
    |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||    
T  46388094 gaacattaatgcgaagaagatgattgaaatggtttagagtgtggggaacgagactctgcaactgattttcattcaagtaaatgtcttaatgttttgtaca 46388193  T
Q  201 attaactatctgaggtccaagttgaccataaatat 235  Q
    |||||||||||||||||||||||||||||||||||    
T  46388194 attaactatctgaggtccaagttgaccataaatat 46388228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University