View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15415_high_28 (Length: 269)

Name: NF15415_high_28
Description: NF15415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15415_high_28
NF15415_high_28
[»] chr7 (2 HSPs)
chr7 (1-162)||(42038009-42038170)
chr7 (231-269)||(42037902-42037940)


Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 42038170 - 42038009
Alignment:
Q  1 aatcttgtgtgagtgtctgtgttggggtctcagcgggcttgggtggtttgtcttccaattctcgacagcccattaggtttggtccctctccctgttcccc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  42038170 aatcttgtgtgagtgtctgtgttggggtctcagcgggcttgggtggtttgtcttccaatcctcgacagcccattaggtttggtccctctccctgttcccc 42038071  T
Q  101 tagggaatgggcaacttccgacgagtagtctggttttggaggttattctcaggtttttggga 162  Q
    ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||    
T  42038070 tagggaatgggcaacttccgacgggtagtctggttttgtaggttattctcaggtttttggga 42038009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 231 - 269
Target Start/End: Complemental strand, 42037940 - 42037902
Alignment:
Q  231 ggtacccctggggctcaggctgctattttctgtttgttt 269  Q
    ||||||||||||||||||||||||| |||||||||||||    
T  42037940 ggtacccctggggctcaggctgctactttctgtttgttt 42037902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University