View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1540_low_24 (Length: 243)

Name: NF1540_low_24
Description: NF1540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1540_low_24
NF1540_low_24
[»] chr4 (1 HSPs)
chr4 (23-152)||(29215323-29215455)
[»] chr8 (3 HSPs)
chr8 (157-227)||(14606495-14606565)
chr8 (158-226)||(14297276-14297344)
chr8 (184-227)||(14312356-14312399)


Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 23 - 152
Target Start/End: Complemental strand, 29215455 - 29215323
Alignment:
Q  23 ttaaatactaattcacatgtgctaagtatatgcgtattattacacatgtgttcgaaatgtttattttgcaatgcactttcatgtaggccttaataaacgc 122  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29215455 ttaagtactaattcacatgtgctaagtatatgcgtattattacacatgtgttcgaaatgtttattttgcaatgcactttcatgtaggccttaataaacgc 29215356  T
Q  123 aatg---caagagcgtcgacaagtattcttagt 152  Q
    ||||   ||||||||||||||||||||||||||    
T  29215355 aatgcaacaagagcgtcgacaagtattcttagt 29215323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 227
Target Start/End: Original strand, 14606495 - 14606565
Alignment:
Q  157 ctgaatccggtagcttttctatgtgagtaccagaaaggtctagataacggagatgcttgagattgcctatg 227  Q
    |||||||| ||||||| | |||||  |||||||| | ||||||| ||||||||||||||||||||||||||    
T  14606495 ctgaatccagtagcttctttatgttggtaccagagacgtctagaaaacggagatgcttgagattgcctatg 14606565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 158 - 226
Target Start/End: Complemental strand, 14297344 - 14297276
Alignment:
Q  158 tgaatccggtagcttttctatgtgagtaccagaaaggtctagataacggagatgcttgagattgcctat 226  Q
    ||||||||||||||||| |||||  ||| |||||||||| |||||||||||||| || ||||| |||||    
T  14297344 tgaatccggtagcttttttatgtttgtatcagaaaggtcgagataacggagatgtttaagatttcctat 14297276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 184 - 227
Target Start/End: Complemental strand, 14312399 - 14312356
Alignment:
Q  184 taccagaaaggtctagataacggagatgcttgagattgcctatg 227  Q
    |||||||||||||||||||||||||||| || ||||||||||||    
T  14312399 taccagaaaggtctagataacggagatgtttaagattgcctatg 14312356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University