View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1540_low_23 (Length: 245)

Name: NF1540_low_23
Description: NF1540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1540_low_23
NF1540_low_23
[»] chr4 (1 HSPs)
chr4 (1-222)||(40839889-40840110)


Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 40840110 - 40839889
Alignment:
Q  1 gcgtgggacctggatgggagtgccaagaagacttaacgttttgcttgcagggtctgttatcagctgcaagtatagacagcaatttcggattgacaagaca 100  Q
    |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40840110 gcgtggaacctggatgggagtgtcaagaagacttaacgttttgcttgcagggtctgttatcagctgcaagtatagacagcaatttcggattgacaagaca 40840011  T
Q  101 ctgcccaagaagacgtaaagagtatcgtatgctagcaacaaaggcgatattgttttagagtgtggcttattaattcgatgtgcggatggagaatggctta 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  40840010 ctgcccaagaagacgtaaagagtatcgtatgctagcaacaaaggcgatattgttttagagtgtggcttattaattcgatgtgcggatggagaatggcttg 40839911  T
Q  201 gtggtttctacaaggatattgg 222  Q
    ||||||||||||||||||||||    
T  40839910 gtggtttctacaaggatattgg 40839889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University