View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1540_high_17 (Length: 235)

Name: NF1540_high_17
Description: NF1540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1540_high_17
NF1540_high_17
[»] chr4 (1 HSPs)
chr4 (16-211)||(40839889-40840084)


Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 40840084 - 40839889
Alignment:
Q  16 gaagacttaacgttttgcttgcagggtctgttatcagctgcaagtatagacagcaattgcggattgacaagacactgcccaagaagacgtaaagagtatc 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  40840084 gaagacttaacgttttgcttgcagggtctgttatcagctgcaagtatagacagcaatttcggattgacaagacactgcccaagaagacgtaaagagtatc 40839985  T
Q  116 gtatgctagcaacaaaggcgatattgttttagagtgtggcttattaattcgatgtgcggatggagaatggcttagtggtttctacaaggatattgg 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  40839984 gtatgctagcaacaaaggcgatattgttttagagtgtggcttattaattcgatgtgcggatggagaatggcttggtggtttctacaaggatattgg 40839889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University