View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15408_low_37 (Length: 256)

Name: NF15408_low_37
Description: NF15408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15408_low_37
NF15408_low_37
[»] chr5 (1 HSPs)
chr5 (17-256)||(2251333-2251572)


Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 17 - 256
Target Start/End: Original strand, 2251333 - 2251572
Alignment:
Q  17 tacgggtagaggatgaaaatgtacataaaaataaaaggaaaaatgttacaatgatattaggggaagctataatgtttttggccatggtgtgattaattgt 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  2251333 tacgggtagaggatgaaaatgtacataaaaataaaaggaaaaatgttacaatgatattgggggaagctataatgtttttggccatggtgtgattaattgt 2251432  T
Q  117 tgatcaagtaacgaatttagaaattgaattgatatataaggagttgtggtgagttataatgtggatatagagaagtactaaatagagaagagttctattt 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2251433 tgatcaagtaacgaatttagaaattgaattgatatataaggagttgtggtgagttataatgtggatatagagaagtactaaatagagaagagttctattt 2251532  T
Q  217 gggaggttgagcagcaaagaacggaaagatggatggagaa 256  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  2251533 gggaggttgagcagcaaagaacggaaagatggatggagaa 2251572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University