View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15408_high_26 (Length: 309)

Name: NF15408_high_26
Description: NF15408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15408_high_26
NF15408_high_26
[»] chr4 (1 HSPs)
chr4 (1-297)||(1797938-1798234)


Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 1797938 - 1798234
Alignment:
Q  1 tagatccggccgcatctccggtgtcggtggtgttggaagaagctgttttcgggtctcggcgccgacggtgctttgttgttttcgtaccacccttcttcta 100  Q
    |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |    
T  1797938 tagatctggccgcatctccggcgtcggtggtgttggaagaagctgttttcgggtctcggcgccgacggtgctgtgttgttttcgtaccacccttcttcca 1798037  T
Q  101 gatatgccgcatttccggcaccggtggttgtggaaaaagttgtttttgggtccggcaccgacggtggtttgtgggtttcgtttgggtggtcgtgattctg 200  Q
    ||| |||||||| |||| ||||||||||||||||| |||||||||||||||| | || ||| ||||||||||||||||||||||||||||||||| ||||    
T  1798038 gatctgccgcatctccgacaccggtggttgtggaagaagttgtttttgggtctgacatcgatggtggtttgtgggtttcgtttgggtggtcgtgactctg 1798137  T
Q  201 gtctttggtttgtgtaagaaccactgttgtgtttctgtgatgggtcgttgctcgttgatctgcaaatgctatttcaagctggtttgttttggatttt 297  Q
    ||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||| |||| | ||||||||||    
T  1798138 gtctttggtttgtgtaagaaccattgttgtgtttccgtaatgggtcgttgctcgttgatctgcaaatgctatttcaagcgggttggctttggatttt 1798234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University