View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15401_low_70 (Length: 213)

Name: NF15401_low_70
Description: NF15401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15401_low_70
NF15401_low_70
[»] chr7 (1 HSPs)
chr7 (1-201)||(33992000-33992202)
[»] scaffold0066 (1 HSPs)
scaffold0066 (33-61)||(14935-14963)


Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 33992000 - 33992202
Alignment:
Q  1 taaacgtgaataaaaaattttgaagactaaactttaaaagtttataattttgtagggactaannnnnnnnnaatgtcaactctca--gagaattttgtca 98  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||         ||||||||||||||  ||||||||| |||    
T  33992000 taaacgtgaataaaaaattttggagactaaactttaaaagtttataattttgtagggactaatttttttttaatgtcaactctcatagagaattttatca 33992099  T
Q  99 tttgcaattatgatctacttgactcaagtgattaatctcttgcacactgaagaatactcgattaaaatcaaaaattaatgtcaaatgtgtcatttgatct 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  33992100 tttgcaattatgatctacttgactcaagtgattaatctcttgcacaccaaagaatactcgattaaaaacaaaaattaatgtcaaatgtgtcatttgatct 33992199  T
Q  199 tga 201  Q
    |||    
T  33992200 tga 33992202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0066 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0066
Description:

Target: scaffold0066; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 61
Target Start/End: Complemental strand, 14963 - 14935
Alignment:
Q  33 tttaaaagtttataattttgtagggacta 61  Q
    |||||||||||||||||||||||||||||    
T  14963 tttaaaagtttataattttgtagggacta 14935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University