View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15401_low_69 (Length: 217)

Name: NF15401_low_69
Description: NF15401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15401_low_69
NF15401_low_69
[»] chr8 (1 HSPs)
chr8 (13-199)||(42223276-42223462)


Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 42223276 - 42223462
Alignment:
Q  13 gtgagatgaaattgactaagaagatatttataaattaaaattctggtgggtggatgcgatctgattacatttcagcccaaaagatgcaagtgcaactctg 112  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  42223276 gtgaaatgaaattgactaagaagatatttataaattaaaattctggtgggtggatgtgatctgattacatttcagcccaaaagatgcaagtgcaactctg 42223375  T
Q  113 taagagaagtgtgctgcttaataaacttcaggcattgctttaggcaatgataaaattgcatctttaaaaacaaaacatcccaacaag 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42223376 taagagaagtgtgctgcttaataaacttcaggcattgctttaggcaatgataaaattgcatctttaaaaacaaaacatcccaacaag 42223462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University