View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15401_low_68 (Length: 224)

Name: NF15401_low_68
Description: NF15401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15401_low_68
NF15401_low_68
[»] chr5 (1 HSPs)
chr5 (13-206)||(41035216-41035404)


Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 13 - 206
Target Start/End: Original strand, 41035216 - 41035404
Alignment:
Q  13 gtgagaagaaaataagaaacagagagaaaattagatattaaatgaatgccgaaaagttagatgagcacaaatgtaagagctcaatcaaaaaattagtatt 112  Q
    |||| ||||||||||||||| |||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  41035216 gtgataagaaaataagaaactgagagaaaattagatat-----gaatgccgaaaagttagatgagcacaaatgtaagagctcaatcaaagaattagtatt 41035310  T
Q  113 tgtggctccgtgcgatgcaacaaatttagatcaaggacacctgttttattgcaaagaatgaaagaagaaaagaaaatattgctcatgtgaaaca 206  Q
    | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||    
T  41035311 tatggctccgtgcgatgcaacaaatttagatcaacgacacctgttttattgcaaagaatgagagaagaaaagaaaatattgcttatgtgaaaca 41035404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University