View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1539_low_10 (Length: 393)

Name: NF1539_low_10
Description: NF1539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1539_low_10
NF1539_low_10
[»] chr6 (2 HSPs)
chr6 (244-378)||(16832268-16832402)
chr6 (166-222)||(16978088-16978144)


Alignment Details
Target: chr6 (Bit Score: 111; Significance: 6e-56; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 244 - 378
Target Start/End: Original strand, 16832268 - 16832402
Alignment:
Q  244 tatttctttttccgaataaagaaaattcgagtgctaaactaaaggttaacaatatcaagaaatcactctatcaggttagtgtataggaaagtagaatatc 343  Q
    |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  16832268 tatttcgttttccgaataaagaaaattcaagtgctaaactaaaggttaacaatatcaagaaatcactctatcaggttagtttataggaaagtagaatatc 16832367  T
Q  344 aacataaaatataccagggaacaaggtgtttaact 378  Q
    |||| ||||| |||||||||| |||||||||||||    
T  16832368 aacacaaaatgtaccagggaataaggtgtttaact 16832402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 222
Target Start/End: Original strand, 16978088 - 16978144
Alignment:
Q  166 caaaattttgtttcgcaacctttcaaaccgatcaaaagctttttccttataggtgag 222  Q
    ||||| |||| ||||||||||||| ||||||| ||||||||| | ||||||||||||    
T  16978088 caaaaatttgattcgcaacctttctaaccgatgaaaagctttcttcttataggtgag 16978144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University