View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15399_high_23 (Length: 234)

Name: NF15399_high_23
Description: NF15399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15399_high_23
NF15399_high_23
[»] chr5 (1 HSPs)
chr5 (66-216)||(22599611-22599761)


Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 66 - 216
Target Start/End: Original strand, 22599611 - 22599761
Alignment:
Q  66 ataaaataacatatcaaaattgttatgcgactttggtgagtggaaattcagcacctttttagagtctagtatatattaagcttttgattacatggaaaat 165  Q
    |||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  22599611 ataaaataacatataaaaattgttatgcgactttgttgagtggaaattcagcacctttttagagtctagtatatattatgcttttgattacatggaaaat 22599710  T
Q  166 ggaaaataaaagcaaaatggtgtaggtaggttagggtttaggagtaggaat 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22599711 ggaaaataaaagcaaaatggtgtaggtaggttagggtttaggagtaggaat 22599761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University