View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15395_low_19 (Length: 385)

Name: NF15395_low_19
Description: NF15395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15395_low_19
NF15395_low_19
[»] chr5 (1 HSPs)
chr5 (11-151)||(41782115-41782255)


Alignment Details
Target: chr5 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 11 - 151
Target Start/End: Complemental strand, 41782255 - 41782115
Alignment:
Q  11 cacagaagcatatcatgtaccattaacttcctacaacaacaaaagcaagcattaacgaatcttttcaagccccgaacagtctcatatcaaacaaaatgaa 110  Q
    |||| ||| |||||||||||||| |||| |||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  41782255 cacataagtatatcatgtaccatcaactccctacaacgacaaaagcaagtattaacgaatcttttcaagccccaaacagtctcatatcaaacaaaatgaa 41782156  T
Q  111 tgactaggatattacaattgtccaaatttagtcacaagaca 151  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  41782155 tgactaggatattacaattgtccaaatttagtcacaagaca 41782115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University