View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1538_low_25 (Length: 256)

Name: NF1538_low_25
Description: NF1538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1538_low_25
NF1538_low_25
[»] chr1 (2 HSPs)
chr1 (100-240)||(40033659-40033790)
chr1 (22-62)||(40033834-40033874)


Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 100 - 240
Target Start/End: Complemental strand, 40033790 - 40033659
Alignment:
Q  100 tatctaactatcctaaatgataagaacacatcaaatagaaatgaaattgtaccctaaattgtgcgaaagaaatttaccttgaatgaagttactcagaaac 199  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  40033790 tatctaactatcctaaatgataagaacacatcaaatagaaacgaaattgtaccctaaattgtgagaaagaaatttaccttgaatgaagttactcagaaac 40033691  T
Q  200 cctagaaccggtagagaaaatgaaatggtgagagaataaac 240  Q
    ||         ||||||||||||||||||||||||||||||    
T  40033690 cc---------tagagaaaatgaaatggtgagagaataaac 40033659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 22 - 62
Target Start/End: Complemental strand, 40033874 - 40033834
Alignment:
Q  22 cataaacttaagcataaacattattatcatgatcgaatacg 62  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  40033874 cataaacttaagcataaacattattatcatgatcgaatacg 40033834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University