View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1538_low_21 (Length: 265)

Name: NF1538_low_21
Description: NF1538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1538_low_21
NF1538_low_21
[»] chr4 (1 HSPs)
chr4 (36-250)||(41446518-41446732)


Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 36 - 250
Target Start/End: Original strand, 41446518 - 41446732
Alignment:
Q  36 gaaaggttcaatgaaaaaagggtaattttagaagctgaagaaacggatagtgatgaagatgaagatgttggagaactaaaacagagtgttgaaagtgtaa 135  Q
    |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  41446518 gaaaggtttattgaaaaaagggtaattttagaagctgaagaaacggatagtgatgaagatgaagatgttggagaactaaaacagagtgttaaaagtgtaa 41446617  T
Q  136 aaacagaggaaccaagttcttcatctttgagtggtggcatagacacggggagtgatgaaggacctgatgtggataaaaaagctgatgaattcattgccaa 235  Q
    |||||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41446618 aaacagaggaaccatgttcttcatctttgagtggtggcatagacacagtgagtgatgaaggacctgatgtggataaaaaagctgatgaattcattgccaa 41446717  T
Q  236 attcagagaacaaat 250  Q
    |||||||||||||||    
T  41446718 attcagagaacaaat 41446732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University