View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15388_low_12 (Length: 221)

Name: NF15388_low_12
Description: NF15388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15388_low_12
NF15388_low_12
[»] chr2 (1 HSPs)
chr2 (21-209)||(39984365-39984553)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 21 - 209
Target Start/End: Original strand, 39984365 - 39984553
Alignment:
Q  21 gaagacacaatagctgaagtggaactagaagatgaacatgttggtgatgatatagaagataaagtgcaaacacaacaaacacttttctcacatttaccat 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||    
T  39984365 gaagacacaatagctgaagtggaactagaagatgaacatgttggtgatgaagaagaagataaagtgcaaacacaacaaacacttttctcacatttaccat 39984464  T
Q  121 tgctacacacattcttcttaacttcagttatggaatcattcagatcaatttccatgaacacctacaatgttttgtggttggttcatctc 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  39984465 tgctacacacattcttcttaacttcagttatggaatcattcagatcaatttccatgaacacctacaatgttttgtggttggttcttctc 39984553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University