View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15386_low_6 (Length: 270)

Name: NF15386_low_6
Description: NF15386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15386_low_6
NF15386_low_6
[»] chr7 (1 HSPs)
chr7 (1-184)||(29959662-29959845)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 29959845 - 29959662
Alignment:
Q  1 ttaattggtacacattggtaaaactatatatggttggtcttacatcaatggaattgactttcttgggagcttttcttgccgtctgggacattgttgttct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29959845 ttaattggtacacattggtaaaactatatatggttggtcttacatcaacggaattgactttcttgggagcttttcttgccgtctgggacattgttgttct 29959746  T
Q  101 tttgctgtaccttgataataatcacactgaaaaagaaaattgcatcatactgataattaaattttgacagtgatctcgtagact 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||    
T  29959745 tttgctgtaccttgataataatcacactgaaaaagaaaattgcatcacattgataattaaattttgacagtgatctcgtagact 29959662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University