View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15384_low_7 (Length: 252)

Name: NF15384_low_7
Description: NF15384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15384_low_7
NF15384_low_7
[»] chr3 (2 HSPs)
chr3 (149-239)||(40255893-40255983)
chr3 (1-77)||(40256051-40256127)


Alignment Details
Target: chr3 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 149 - 239
Target Start/End: Complemental strand, 40255983 - 40255893
Alignment:
Q  149 gacattattggcataaattttaaataagttatctacaactaaatacttaaaattaaattggtccaaaatattaatgtcaaactggtcccct 239  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40255983 gacattattggcataaattttaaatgagttatctacaactaaatacttaaaattaaattggtccaaaatattaatgtcaaactggtcccct 40255893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 40256127 - 40256051
Alignment:
Q  1 tttgctgaaattgaaattgttaatttaagcaaaatgcatcccaagttggtggagcttgagatgaaaaaattgaagac 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40256127 tttgctgaaattgaaattgttaatttaagcaaaatgcatcccaagttggtggagcttgagatgaaaaaattgaagac 40256051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University