View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15379_high_6 (Length: 285)

Name: NF15379_high_6
Description: NF15379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15379_high_6
NF15379_high_6
[»] chr1 (1 HSPs)
chr1 (20-259)||(43965212-43965444)


Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 259
Target Start/End: Complemental strand, 43965444 - 43965212
Alignment:
Q  20 tggtggatatgatttagatagagcctgtagacaagattttcttgacaaaaattaaaaacaaagaataaggacttcttttcatgttaaccctcaagttttt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||    
T  43965444 tggtggatatgatttagatagagcctgtagacaagattttcttgacaaaaattaaaaacaa-------ggacttcttttcatgttaaccctcaagttttt 43965352  T
Q  120 aggggaatgcgaccttggtagagctcggccataaagtaaatataacctcattaaaaattgttaatcgaatacggtatctctcttgaataattcattcatt 219  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43965351 aggggaatgagaccttggtagagctcggccataaagtaaatataacctcattaaaaattgttaatcgaatacggtatctctcttgaataattcattcatt 43965252  T
Q  220 aatagagttcattaaccacttgacctcaattgtttgatca 259  Q
    ||||||||||||||||||||||| ||||||||||||||||    
T  43965251 aatagagttcattaaccacttgatctcaattgtttgatca 43965212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University