View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15376_low_32 (Length: 214)

Name: NF15376_low_32
Description: NF15376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15376_low_32
NF15376_low_32
[»] chr1 (3 HSPs)
chr1 (74-135)||(43219416-43219477)
chr1 (1-47)||(43219478-43219524)
chr1 (158-195)||(43219335-43219372)


Alignment Details
Target: chr1 (Bit Score: 62; Significance: 6e-27; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 74 - 135
Target Start/End: Complemental strand, 43219477 - 43219416
Alignment:
Q  74 tccgtcaatgtcaatttagtttctataatgtacaatgtactatcaattaacacatggtttca 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43219477 tccgtcaatgtcaatttagtttctataatgtacaatgtactatcaattaacacatggtttca 43219416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 43219524 - 43219478
Alignment:
Q  1 ttatccttgactctgtcaacattgctcattttcatccttttgtcaat 47  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  43219524 ttatccttgactctgtcaacattgctcattttcatccttttgtcaat 43219478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 195
Target Start/End: Complemental strand, 43219372 - 43219335
Alignment:
Q  158 tttgttttagacttcattcactcttaggctgacctagg 195  Q
    ||||||||||||||||||||||||||||||||||||||    
T  43219372 tttgttttagacttcattcactcttaggctgacctagg 43219335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University