View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15375_low_15 (Length: 218)

Name: NF15375_low_15
Description: NF15375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15375_low_15
NF15375_low_15
[»] chr1 (1 HSPs)
chr1 (1-202)||(35697170-35697371)


Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 35697170 - 35697371
Alignment:
Q  1 ggaccggtggagacagatagatataccgcaggtttatgatcatttggggaataataataatgatagtgtgaagaaaactgggaaacaaacgaaagggaaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  35697170 ggaccggtggagacagatagatataccgcaggtttatgatcatttggggaataataataatggtagtgtgaagaaaactgggaaacaaacgaaagggaaa 35697269  T
Q  101 ggtaaaggtaagcatcgaaggcaaggtagcggtttgttttcgtgctttggaacagcattagggtgtgagatttcaataacttgtggagggggtaaccata 200  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||    
T  35697270 ggtaaaggtaagaatcgaaggcaaggtagcggtttgttttcgtgctttggaacagcattagggtgtgagatttcgataacttgcggagggggtaaccata 35697369  T
Q  201 ag 202  Q
    ||    
T  35697370 ag 35697371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University