View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15374_low_19 (Length: 227)

Name: NF15374_low_19
Description: NF15374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15374_low_19
NF15374_low_19
[»] chr7 (1 HSPs)
chr7 (98-214)||(42014868-42014987)


Alignment Details
Target: chr7 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 98 - 214
Target Start/End: Complemental strand, 42014987 - 42014868
Alignment:
Q  98 tacggatagaatacactttttgcgttatctatcagcaggactgtaaaatattt---nnnnnnnnnnnnnnntggtatagttctgtatcccctaaacttct 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||                  |||||||||||||||||||||||||||||    
T  42014987 tacggatagaatacactttttgcgttatctatcagcaggactgtaaaatatttaaaaaaataaaataaaaatggtatagttctgtatcccctaaacttct 42014888  T
Q  195 cttccatgtcacattcattt 214  Q
    ||||||||||||||| ||||    
T  42014887 cttccatgtcacattgattt 42014868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University