View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15372_low_16 (Length: 248)

Name: NF15372_low_16
Description: NF15372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15372_low_16
NF15372_low_16
[»] chr4 (1 HSPs)
chr4 (13-225)||(56401372-56401584)


Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 225
Target Start/End: Complemental strand, 56401584 - 56401372
Alignment:
Q  13 gagaagaataaatagatattttttaaccttcttaagcaattggctgcagataggtgctccggcacggaggagacgcattctggcacggtggtcgcggaaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  56401584 gagaagaataaatagatattttttaaccttcttaagcaattggctgcagataggtgctccggcacggaggagacgcattctggcacggtggtcgcggaaa 56401485  T
Q  113 ataagctctgacaggaactctggtttagggtttatgtttctggattctagaggagtccatccatcggcttaaaatcttggctgtaggtagtaataaaaaa 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||||    
T  56401484 ataagctctgacaggaactctggtttagggtttatgtttctggattctagaggaatccatccatgggcttaaaatcttggttgtaggtagtaataaaaaa 56401385  T
Q  213 ttaacttggtgca 225  Q
    |||||||||||||    
T  56401384 ttaacttggtgca 56401372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University