View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15367_high_7 (Length: 314)

Name: NF15367_high_7
Description: NF15367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15367_high_7
NF15367_high_7
[»] chr5 (1 HSPs)
chr5 (19-158)||(29791841-29791980)


Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 29791841 - 29791980
Alignment:
Q  19 atatgatatgagcacggggtgattctctagtaaggcattgtgaagtttttcccattcaccccttctttgcacattggaccactcaccttcatttcttaca 118  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||||    
T  29791841 atatgatatgagcacggggtgattctctagtaaggcattttgaagtttttcccattcaccccttatttgcacattcgaccactcaccttcatctcttaca 29791940  T
Q  119 tacttctcttggtcatctagtatggagaggttggtctatg 158  Q
    ||||||||||||| ||||||||||||||||||||||||||    
T  29791941 tacttctcttggttatctagtatggagaggttggtctatg 29791980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University