View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15363_low_28 (Length: 256)

Name: NF15363_low_28
Description: NF15363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15363_low_28
NF15363_low_28
[»] chr1 (2 HSPs)
chr1 (132-238)||(14412453-14412559)
chr1 (1-107)||(14412358-14412470)


Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 132 - 238
Target Start/End: Original strand, 14412453 - 14412559
Alignment:
Q  132 aaaattcaaaatccaattgtaatcgatcttagtagtttagaaatcattggtgttttcaaattaaatgaattcatactcaatattgggttaaattgaaggt 231  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14412453 aaaattcaaaatccaattgtaatctatcttagtagtttagaaatcattggtgttttcaaattaaatgaattcatactcaatattgggttaaattgaaggt 14412552  T
Q  232 tcatatg 238  Q
    |||||||    
T  14412553 tcatatg 14412559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 14412358 - 14412470
Alignment:
Q  1 ttgggaaagaattgttacaagaaatttgatcttatatgggaagtgaagatgctagatt------caagatagagaggttacatatatgcttctttaaaat 94  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||      ||||||||||||||||||||||||||||||||||||    
T  14412358 ttgggaaagaattgttacaagaaatttgatcttatatggaaagtgaagatgctagattcaagaccaagatagagaggttacatatatgcttctttaaaat 14412457  T
Q  95 tcaaaatccaatt 107  Q
    |||||||||||||    
T  14412458 tcaaaatccaatt 14412470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University