View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15351_low_17 (Length: 436)

Name: NF15351_low_17
Description: NF15351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15351_low_17
NF15351_low_17
[»] chr1 (4 HSPs)
chr1 (216-289)||(40869586-40869659)
chr1 (344-426)||(40869470-40869546)
chr1 (103-144)||(40869731-40869772)
chr1 (18-50)||(40869825-40869857)


Alignment Details
Target: chr1 (Bit Score: 74; Significance: 8e-34; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 216 - 289
Target Start/End: Complemental strand, 40869659 - 40869586
Alignment:
Q  216 ggatctgaatcgaatatgtgaattaattcaatggaatcgatcaacttaatgttgaattctccagcttcatactt 289  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40869659 ggatctgaatcgaatatgtgaattaattcaatggaatcgatcaacttaatgttgaattctccagcttcatactt 40869586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 344 - 426
Target Start/End: Complemental strand, 40869546 - 40869470
Alignment:
Q  344 gtgtgatgcgattctcgaattatggatttttctgtatgaattatcatcatgatgaatgattgatgttgttcgtaccaaccgat 426  Q
    |||||||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||    
T  40869546 gtgtgatgcgattctcgaattatggatttttctgtatgaattatc------atgaatgattgatgttgttcgtaccaaccgat 40869470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 103 - 144
Target Start/End: Complemental strand, 40869772 - 40869731
Alignment:
Q  103 gaaggatgatcaatttcttaattgatttctttttctttatgg 144  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  40869772 gaaggatgatcaatttcttaattgatttctttttctttatgg 40869731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 40869857 - 40869825
Alignment:
Q  18 cttcataattacgtaaattaattaattacacga 50  Q
    |||||||||||||||||||||||||||||||||    
T  40869857 cttcataattacgtaaattaattaattacacga 40869825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University