View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15348_low_10 (Length: 275)

Name: NF15348_low_10
Description: NF15348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15348_low_10
NF15348_low_10
[»] chr1 (2 HSPs)
chr1 (145-260)||(23807308-23807423)
chr1 (13-81)||(23806584-23806652)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 145 - 260
Target Start/End: Original strand, 23807308 - 23807423
Alignment:
Q  145 agatatctttagtgtatcttgcttgaagttagagatttcttgatacgaattttctactcgaactctatcacctcgaagacaatattttcattgaagacga 244  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  23807308 agatatctttagtgtatcttgcttgaagttagagatttcttgatacaaattttctactcaaactctatcacctcgaagacaatattttcattgaagacga 23807407  T
Q  245 tgctttttggaacttg 260  Q
    ||||||||| ||||||    
T  23807408 tgctttttgaaacttg 23807423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 13 - 81
Target Start/End: Original strand, 23806584 - 23806652
Alignment:
Q  13 aaaatattgaagcacatgcattacacatattggaacaactttttgcatgtcacgtgatgtgcatatata 81  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23806584 aaaatattgaagcacatgcattacacatattggaacaactttttgcatgtcacgtgatgtgcatatata 23806652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University