View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15346_low_12 (Length: 290)

Name: NF15346_low_12
Description: NF15346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15346_low_12
NF15346_low_12
[»] chr5 (1 HSPs)
chr5 (70-189)||(24078696-24078815)


Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 70 - 189
Target Start/End: Original strand, 24078696 - 24078815
Alignment:
Q  70 gcatagaagctactatgaagtttcttcctcacttctttttgctcatttccacaatgaaaatggtgaaaattgctcttccttctggtaaaatggagatcaa 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24078696 gcatagaagctactatgaagtttcttcctcacttctttttgctcatttccacaatgaaaatggtgaaaattgctcttccttctggtaaaatggagatcaa 24078795  T
Q  170 atatctttcactctctctga 189  Q
    ||||||||||||||||||||    
T  24078796 atatctttcactctctctga 24078815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University