View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15345_high_6 (Length: 246)

Name: NF15345_high_6
Description: NF15345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15345_high_6
NF15345_high_6
[»] chr2 (1 HSPs)
chr2 (1-231)||(1742425-1742655)


Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 1742655 - 1742425
Alignment:
Q  1 cctgaggtgaaggaatttccattggcattgcctggtggtgaagtgaggaagaggaagagagggaggaaacctaaagtgaaagcgcatttggaggaagaga 100  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1742655 cctgaggtgaaggaatttccattggcattgcctgctggtgaagtgaggaagaggaagagagggaggaaacctaaagtgaaagcgcatttggaggaagaga 1742556  T
Q  101 ttgtgaataaaaacggtgttgtgattgattttggtgctttatcggaggtggagcatccttttgcagcggagattgcgagaaggacggaagggttaaagga 200  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||    
T  1742555 ttgtgaataaaaacggtgttgtgattgattttgctgctttatcggaggttgagcatccttttgctgcggagattgcgagaaggacggaagggttaaagga 1742456  T
Q  201 ggaagaggagttgttagggtttttgagtgat 231  Q
    |||||||||||||||||||||||||||||||    
T  1742455 ggaagaggagttgttagggtttttgagtgat 1742425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University