View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15342_low_51 (Length: 226)

Name: NF15342_low_51
Description: NF15342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15342_low_51
NF15342_low_51
[»] scaffold0114 (1 HSPs)
scaffold0114 (17-226)||(5777-5986)


Alignment Details
Target: scaffold0114 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: scaffold0114
Description:

Target: scaffold0114; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 5986 - 5777
Alignment:
Q  17 aggtacgtgcggtctctaaacatatgtccattcttcatgatggggataatgtcatctcggacccaattgagatagaggaccatgttgtgtcatattttca 116  Q
    ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  5986 aggtacgtgcggtttctaaacatatgtccattcttcatgatagggataatgtcatctcggacccaattgagatagaggagcatgttgtgtcatattttca 5887  T
Q  117 gtctatttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagaatgatttattatgttgc 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |     
T  5886 gtctatttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagactgatttattatgtcgt 5787  T
Q  217 ttaccgatga 226  Q
    ||||| ||||    
T  5786 ttacctatga 5777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University