View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15341_low_16 (Length: 281)

Name: NF15341_low_16
Description: NF15341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15341_low_16
NF15341_low_16
[»] chr2 (1 HSPs)
chr2 (114-259)||(45102601-45102736)


Alignment Details
Target: chr2 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 114 - 259
Target Start/End: Complemental strand, 45102736 - 45102601
Alignment:
Q  114 attattctaatttaatttattactagtaacgctcatgttagagttactagtaataattctcacattattagtacaaataattctaacattatttatatcg 213  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||       
T  45102736 attattcgaatttaatttattactagtaacgctcatgttagagttactagtaataattctcacattattagtacaaataattctaaaattatttata--- 45102640  T
Q  214 ttcctttcatacgatctagtatgattggaatatacagtaataaatg 259  Q
    |||       ||||||||||||||||||||||||||||||||||||    
T  45102639 ttc-------acgatctagtatgattggaatatacagtaataaatg 45102601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University