View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1533_high_2 (Length: 210)

Name: NF1533_high_2
Description: NF1533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1533_high_2
NF1533_high_2
[»] chr3 (1 HSPs)
chr3 (17-194)||(34384620-34384797)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 34384620 - 34384797
Alignment:
Q  17 atcatggaggttgttgcaagaattgttggagcctgcacttctgaactttacattttccttaatgtctattagccttgttgcaaacctaataaatagtaaa 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34384620 atcatggaggttgttgcaagaattgttggagcctgcacttctgaactttacattttccttaatgtctattagccttgttgcaaacctaataaatagtaaa 34384719  T
Q  117 agatgtcggcagaggactaagaaatggaagggaaaaaatgtgatctcaattgaaatgagagacttactgggttccttc 194  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  34384720 agatgtcggcagaggactaagaaattgaagggaaaaaatgtgatctcaattgtaatgagagacttactgggttccttc 34384797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University