View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15333_low_13 (Length: 206)

Name: NF15333_low_13
Description: NF15333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15333_low_13
NF15333_low_13
[»] chr2 (1 HSPs)
chr2 (1-198)||(40646606-40646803)


Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 40646803 - 40646606
Alignment:
Q  1 tgtttggggtttctgggagtgagttgcgaagagaggttaaggatgttctgcttgagattgatgtatcggttgagagatggaatccggttgaaccggcgta 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40646803 tgtttgggttttctgggagtgagttgcgaagagaggttaaggatgttctgcttgagattgatgtatcggttgagagatggaatccggttgaaccggcgta 40646704  T
Q  101 tgaggttgaagggttgtcggaaaatgatgatgtttttgttttggtggttgcacgtgtgattgtggtacttgcacgtgtgggtttagatgatgatgatg 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  40646703 tgaggttgaagggttgtcggaaaatgatgatgtttttgttttggtggttgcacgtgtgattgtggtacttgcacgtgtgggtttaggtgatgatgatg 40646606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University