View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1532_low_86 (Length: 297)

Name: NF1532_low_86
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1532_low_86
NF1532_low_86
[»] chr5 (1 HSPs)
chr5 (67-226)||(8518606-8518763)


Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 67 - 226
Target Start/End: Original strand, 8518606 - 8518763
Alignment:
Q  67 aaaattacttggttagagaacttcttaattatgacatatgggttatgccccattttcataatctatggttttataaggaattggaatatgaattatgaaa 166  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  8518606 aaaattactttgttagagaacttcttaattatgacatatgggttatgccccattttcagaatctatggttttataaggaattggaatatgaattatgaaa 8518705  T
Q  167 cagaagctggctgagtacagaatatgatatttgcctcagaaagttattaagatgaagact 226  Q
    |||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||    
T  8518706 cagaagctggctgag--cagaatatgatatttgcctcagaaagttattaagatgaagact 8518763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University