View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1532_low_122 (Length: 212)

Name: NF1532_low_122
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1532_low_122
NF1532_low_122
[»] chr4 (1 HSPs)
chr4 (1-126)||(34578273-34578398)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 34578273 - 34578398
Alignment:
Q  1 gccttacctcaaaatattaacattttttgctgacatgccagtttcaggaaacatggccttccttctatttacatcttcgtgaaatgacttgcctgcactt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34578273 gccttacctcaaaatattaacattttttgctgacatgccagtttcaggaaacatggccttccttctatttacatcttcgtgaaatgacttgcctgcactt 34578372  T
Q  101 ggtgtaacatctaaaacaatgccctc 126  Q
    |||||||||||||||||||| |||||    
T  34578373 ggtgtaacatctaaaacaattccctc 34578398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University