View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1532_low_102 (Length: 267)

Name: NF1532_low_102
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1532_low_102
NF1532_low_102
[»] chr6 (2 HSPs)
chr6 (164-257)||(8649824-8649917)
chr6 (46-169)||(8668267-8668388)


Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 164 - 257
Target Start/End: Complemental strand, 8649917 - 8649824
Alignment:
Q  164 agttgtttgttgttttactagctttcatagttttttcagccagatctagtattttcaattcaatttgttgtttggcttcatctttatccctttg 257  Q
    ||||||||||||||||||||||||||||||||| |||  ||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  8649917 agttgtttgttgttttactagctttcatagtttcttcttccagatctagtattttcaattcaatctgttgtttggcttcatctttatccctttg 8649824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 46 - 169
Target Start/End: Complemental strand, 8668388 - 8668267
Alignment:
Q  46 atacctccctccaccgaaatctctcctcctcattttgtattgggccatctaaaagccagatctgttacatcagaacctccccttctgtcannnnnnntat 145  Q
    |||||||||||||||| ||||||||||||||||||  | || |||||||||||||||  ||||| |||||||||||||||||||||||||       |||    
T  8668388 atacctccctccaccggaatctctcctcctcatttcttttttggccatctaaaagccgaatctggtacatcagaacctccccttctgtca--ccccctat 8668291  T
Q  146 tttaaatattgtggttttagttgt 169  Q
    |||||| |||||||||||||||||    
T  8668290 tttaaagattgtggttttagttgt 8668267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University