View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15326_high_13 (Length: 238)

Name: NF15326_high_13
Description: NF15326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15326_high_13
NF15326_high_13
[»] chr3 (1 HSPs)
chr3 (1-220)||(50392994-50393213)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 50392994 - 50393213
Alignment:
Q  1 ctcttaattagtggaggataatgcgcatcattgataagtgattagagggtcgagggatataaccattatttctcttttctctatgaaacnnnnnnnnctt 100  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||    
T  50392994 ctcttaattaatggaggataatgcgcatcattgataagtgattagagggtcgagggatataaccattatttctcttttctctatgaaacttttttttctt 50393093  T
Q  101 taaaataaactgggtaacatatcattttttactgaagctnnnnnnnntatgaaagaaaaagactatctcgatcgcaagaggaaattttttaaccccaaat 200  Q
    |||||||||||||||||||||||||||||||||| ||||        ||||||||||||||||||||||||||| ||||||||| |||||||||||||||    
T  50393094 taaaataaactgggtaacatatcattttttactggagctaaaaaaaatatgaaagaaaaagactatctcgatcgaaagaggaaaatttttaaccccaaat 50393193  T
Q  201 cactgcatagtgagcatatg 220  Q
    ||||||||||||||||||||    
T  50393194 cactgcatagtgagcatatg 50393213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University